1、Synthetic Biology Escherichia coli counter iGEM Summer 2004,Nathan Walsh April 21, 2005,Acknowledgments,Boston University Will Blake Jim Flanigon Farren Isaacs Ellen OShaughnessy Neil Patel Margot Schomp Jim Collins,Harvard University John Aach Patrik Dhaeseleer Gary Gao Jinkuk Kim Xiaoxia Lin Natha
2、n Walsh George Church,Thanks to:Drew Endy & BioBricks community, MIT, Blue Heron and all others who have supported us along the way.,Overview,Objectives & DesignTesting ComponentsGoalsConclusions and Next Steps,Objectives Features/Design Constraints,Ability to count identical inputs or sets of ident
3、ical inputs.Memory of the count recorded in the DNA of current counter (and progeny).Modular bit design and linkage allows array of n-bits to count up to 2nExploit new class of natural mechanisms for use in synthetic biology.,Objectives Potential Applications,Programmed cell death Safety Therapeutic
4、 dosageEnvironmental diagnostic Counting times pollution thresholds exceededMetabolic diagnostic Count the number of times glucose levels exceeded,Phage attachment sitesattP,Design Phage Int/Xis system,Int,Int,Xis,+,attB Bacterial attachment sites,Integrated Left attachment sites attL,Integrated Rig
5、ht attachment sites attR,Stably integrated prophage,P,P,O,B,B,O,P,B,O,P,O,B,Design Phage Int/Xis system with inverted att sites,Int,Int,Xis,Phage attachment sitesattP,Bacterial attachment sites attB*,+,P,P,B,B,O,O,Integrated Right attachment site attR,Integrated Left attachment site attL*,P,B,P,B,O,
6、O,Design Integrase advantages,High fidelity site specific and directional recombination (as opposed to homologous recombination)Reversible excision just as reliable as integrationSpecific each integrase recognize its own att sites, but no othersNumerous over 300 known Tyr integrases and 30 known Ser
7、 integrasesEfficient very few other factors needed to integrate or exciseExtensively used Phage systems well characterized and used extensively in genetic engineering (e.g., the GATEWAY cloning system by Invitrogen),Groth et al., Phage Integrases: Biology and Applications, J. Mol. Biol., 335: 667-67
8、8),Design Full Cycle of Two -bits,1,xis2,reporter1,int2,2,xis1,reporter2,int1,attR1 term attL1*,attP2 term attB2*,int2,int2,Design Chaining bits together,Components Composite half bits in BioBricks, Xis +AAV,ECFP +AAV, Int+ LVA,BBa_E0024,BBa_I11020,BBa_I11021,p22 attP,BBa_I11033,Reverse Terminator,B
9、Ba_B0025,p22 attB (rev comp),BBa_I11032,BBa_I11060 :,P22 Xis +AAV,EYFP +AAV,p22 Int+ LVA,BBa_E0034,BBa_I11030,BBa_I11031, attP,BBa_I11023,Terminator,BBa_B0013, attB (rev comp),BBa_I11022,BBa_I11061 :,Lewis and Hatfull, Nuc. Acid Res., 2001, Vol. 29, 2205-2216 Andersen, Applied and Environmental Micr
10、obiology, 1998, 2240-2246,Two 2kb composite parts are currently being built by Blue Heron:, Half Bit,p22 Half Bit,Components Lutz and Bujard Vector,Testing Construct 1 - Overview,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,Xis,Int,PLlacO,PLtetO,GFP_AAV,attP,attB*,origin,Kan,Stra
11、in must make repressors BU has used dh5aZ1 before -laciq - LacI -PN25 - TetR -endogenous araC,There are two sets of test plasmids, one for lambda and one for P22,T0,Testing Construct 1 No GFP expression,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,Xis,Int,PLlacO,PLtetO,GFP_AAV,at
12、tP,attB*,origin,Kan,dh5aZ1,No GFP expression: -Cant continue after KanR -Cant read through attP,Testing Test Construct 2 Might not be KanR problem,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,Int,Para-1,PLtetO,GFP_AAV,attP,attB*,origin,Kan,dh5aZ1,GFP is not inducible Likely probl
13、em is attP,Testing Test Construct 3 GFP alone works,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,Int,Para-1,PLtetO,GFP_AAV,origin,Kan,dh5aZ1,GFP is produced,Testing GFP is produced in the cells,Testing Construct 1 Possible explanations for failure,Lutz and Bujard, Nuc. Acids Res.
14、, 1997, Vol. 25, No. 6 1203-1210,Xis,Int,PLlacO,PLtetO,GFP_AAV,attP,attB*,origin,Kan,dh5aZ1,Cant read through attP,Beginning of Int and end of Xis overlap by 40 amino acids.,End of Int and attP overlap.,Cant continue after KanR,Cloning Problem near PLlacO in lambda construct (SalI),Testing Test Cons
15、truct 1 Fix,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,Xis,Int,PLlacO,PLtetO,attP,attB*,origin,Kan,dh5aZ1,GFP_AAV,Other Issues:-Digests same size,-Swap attP and attB -Have KanR-GFP intervening sequence be coding,-Mutagenize attP site,-Reclone l Integrase,-Reduce excess space,Go
16、al First bit counter,Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210,PLlacO,Lambda Int,p22 attP,p22 attB*,Lambda Xis,GFP_AAV,pSC101,Kan,p22 Xis,Lambda attB*,Lambda attP,p22 Int,PLtetR,Questions for Discussion Please speak up with ideas!,Is there enough Int?Do the PLlacO and PLtetO l
17、eak?How can we measure levels of Int/Xis?Does Int binding to att block read-through?What other constructs would be useful?,Synthesis and Testing dh5aZ1 and why we need a new strain,Try: OmniMAX2-T1 (invitrogen),How Gateway does it,Gateway uses three methods Promoter attB1 rbs gene of interest attB2
18、Promoter rbs Fusion attB1 gene of interest attB2 Promoter attB1 rbs gene of interest attB2 FusionattB1 and attB2 can be read through with no stop codons but the ribosome binding site (Shine Delgarno) must be included after the attB1 if a native start is required,What we need to change,The Xis-attB-G
19、FP junctionWe want to make a protein across the junctionThe GFP-attP-terminatorWe want the attP and a transcriptional terminator to follow the GFPThe next slides show P22 than lambda,P22Xis-P22attB-GFP junction,xis,attB,rbs,gfp,attP*,rbs,PLtetO,rbs,int*,F-T-M-S-*-*- MRKG- -H-D-K-L-I-T-Q-R-I-R-N-A-K-
20、V-V-K-E-A-A-Y-A-*-ttcatgacaagctaataacgcagcgcattcgtaatgcgaaggtcgttaaggaggcagcctatgcgtaagga,attB,rbs,t0,PLtetO: Lambda phage promoter with tet operator sites acting as repressive elements rbs:Ribosome binding sites (Shine Delgarno) TAAGGAGG is complementary to 16S rRNA attB/attB1: Phage P22 attachment
21、 site in host (capital letters are the Gateway l attB1) xis: Phage P22 excisionase int*: 58 aa coding region to allow GFP in same operon. Corresponds to first 41 aa of Int.,GFP-P22attP region,xis,attB,rbs,gfp,attP,rbs,PLtetO,rbs,int*,t0,A-*-*-taataatttttggtacttctgtcccaaatatgtcccacagtaaaaataaggaaggca
22、cgaataatacgt Aagtatttgatttaactggtgccgataataggagacgaacctacgaccttcgcattacgaattataagaact accttttaagtcaacaacataccacgtcatacctgcgctcacacgtcccatcttcgaaagacatgcaaagcc ttgcaaaccgatgcaaagatttgtatgtcccatttttgtcccaaaccacttag Terminator ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacg ctc
23、tcctgagtaggacaaatccgcc,attP: Phage integrase sites from phage P22 t0: Bacteriophage lambda transcriptional terminator,lXis-lattB-GFP junction,l xis,l attB1,rbs,gfp,l attP1,rbs,PLtetO,rbs,int*,K-A-K-S-*-*- MRKG- -R-R-S-HNNKFVQKSRLRRQA-YA-*AAGGCGAAGTCAtaataACAAGTTTGTACAAAAAAGCAGGCTaaggaggcaggcctatgcgt
24、aagga,attB1,rbs,t0,PLtetO: Lambda phage promoter with tet operator sites acting as repressive elements rbs:Ribosome binding sites (Shine Delgarno) TAAGGAGG is complementary to 16S rRNA attB1: Phage l attachment site attB1 from Gateway (BOB) xis: Phage P22 excisionase int*: 58 aa coding region to all
25、ow GFP in same operon. Corresponds to first 41 aa of Int.,GFP-lattP region,l xis,l attB1,rbs,gfp,l attP1,rbs,PLtetO,rbs,int*,t0,A-*-*-taataacatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatt Taatatattgatatttatatcattttacgtttctcgttca(gcttttttgtacaaacttg)gcattataaaaaa gcattgctcatcaatttgt
26、tgcaacgaacaggtcactatcagtcaaaataaaatcattattt Terminator ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgct ctcctgagtaggacaaatccgcc,attP: Phage integrase sites from phage l modified by Gateway (pop) t0: Bacteriophage lambda transcriptional terminator,0,Sequential D Flip-flop,Me
27、mory Element DNA top half bit,Memory Element DNA bottom half bit,Int alone,Int+Xis,Int alone,Int+Xis,IPTG,TET,Conditional Logic to assure only one signal is passed,Conditional Logic,Int,Int,Sequential D Flip-flops using NOR gates with separate clocks,Circuits,R-S flip-flop (NOR),R-S flip-flop (NAND)
28、,R,S,Q,R,S,Q,Clocked R-S flip-flop (NOR),R,S,Q,CP,Clocked D flip-flop (NOR),D,Q,CP,T flip-flop (NOR),CP,Q,Master Slave D flip-flop (NOR),D,CP,Q,Negative Edge Triggered Flip-flop,D Flip-flop,SR Latch,Multi-University Collaboration,Boston University Ellen OShaughnessy Margot Schomp Jim Collins,Harvard
29、 University John Aach Farren Isaacs Jinkuk Kim Sasha Wait Nathan Walsh George Church,Simulation,Purpose To validate concept + alternatives, identify system sensitivitiesImplementation Mixed ODE / stochastic model using MatLab Simulink No uni-directional terminatorsLevel of Detail Pair of coupled hal
30、f-bits Int and Xis mRNAs and proteins Half-bit DNA states IPTG and tet pulsesParameters Mixture of literature values + model derived estimatesResults so far Stable switching depends on stability of Int vs. Xis,Simulation Results,Pulses: IPTG Tet,DNA,DNA,mRNA: Int-XisInt Protein:Int-XisXisInt,mRNA: I
31、nt-XisInt Protein:Int-XisXisInt,2nd half bit,1st half bit,Seconds,Seconds,Seconds,Simulation processing,Initial configuration,IPTG,0,Int,Xis,0,0,= integrated (attL / attR), requires Int+Xis to switch,tet,0,0,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation p
32、rocessing,First IPTG pulse,0,= integrated (attL / attR), requires Int+Xis to switch,Int,1,= excised (attP / attB), requires Int to switch,Simulation processing,First IPTG pulse,IPTG,0,Int,Xis,0,0,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requires I
33、nt to switch,half-bit 1,half-bit 2,Xis,Simulation processing,Post first IPTG pulse,IPTG,0,Int,Xis,0,0,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,First tet pulse,IPTG,0,Int,Xis,0,
34、0,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,First tet pulse,IPTG,0,Int,Xis,1,1,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requ
35、ires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,Post first tet pulse,IPTG,0,Int,Xis,1,1,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,Second IPTG pulse,IPTG,0,Int
36、,Xis,1,1,= integrated (attL / attR), requires Int+Xis to switch,tet,1,1,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,Second IPTG pulse,IPTG,0,Int,Xis,1,1,= integrated (attL / attR), requires Int+Xis to switch,tet,0,0,Int,1,= excised (attP / at
37、tB), requires Int to switch,half-bit 1,half-bit 2,Xis,Simulation processing,Post second IPTG pulse,IPTG,0,Int,Xis,1,1,= integrated (attL / attR), requires Int+Xis to switch,tet,0,0,Int,1,= excised (attP / attB), requires Int to switch,half-bit 1,half-bit 2,Xis,Model ODEs: example of basic structure,
38、mRNA ODEs: 0 order generation 1st order decay Generation / decay rates expressed as functions of 70, RNAse concentrations, and doubling time Generation depends on variable DNA that represents state of DNA,mRNAInt-Xis=,Amount Synthesized (DNA state),Amount Degraded (mRNAInt-Xis, RNAseH*),-,-,Amount l
39、ost to cell division (mRNA),Model ODEs: additional details,mRNA and protein stored as numbers of molecules Int, Xis protein ODEs include Int-Xis complexing as well as generation, decay, dilution Effect of transcript lengths on transcription and translation taken into account via MatLab “transport de
40、lays” Two sets of variables & equations one for each half-bit 10 variables + 10 equations, not including DNA state variables IPTG and tet: cycles of 4 parts of 1 hr 15min exposure to IPTG, recovery, exposed to Tet, recovery,Stochastic Modeling vs. ODEs,DNA state switching not correctly modeled by ra
41、te equation,Stochastic Modeling switching probability,f(X) = 1-(1-P)XP = probability of integration or excision in time unit / molecule PInt = probability of integration / Int molecule PInt-Xis = probability of excision / Int-Xis complexX = number of molecules of Int or Int-XisAdditional constraint:
42、 X XminImplementation Pick random number U from uniform distribution 01 If (X Xmin) and U f(X), invert DNA state,Matlab “Counter” Specific Models,Protease and RNAse levels are constant The ProtInt and ProtInt-Xis output from one half bit are inputs for other half bit The number of molecules are disp
43、layed on the “oscilliscopes”,Matlab: Molecular Biology Models,mRNA,protein,Matlab Molecular Biology Models,Complex between protein A and protein B,Matlab “Counter” Specific Models,Each half bit combines the switching function, the mRNA, and the protein. The DNA state of each half bit is maintained a
44、s a global variable.,Matlab “Counter” Specific Models,The two half bits differ in that when they are in the integrated state one makes mRNAInt and the other make mRNAInt-Xis.,Simulation Results revisited,Pulses: IPTG Tet,DNA,DNA,mRNA: Int-XisInt Protein:Int-XisXisInt,mRNA: Int-XisInt Protein:Int-Xis
45、XisInt,2nd half bit,1st half bit,Seconds,Seconds,Seconds,Int/Xis degradation rates,The simulation is sensitive to the relative degradation rates of Int and Xis.Previously Int was less stable, but in this simulation the stabilities are equal.,Simulation Next steps and directions,Continue evaluation o
46、f design elements Explore more of parameter space DNA element copy number Reversible terminators Single combined bits vs. coupled half-bits Link multiple bitsIncorporate more biology Continue refining parameters based on research Add additional molecules RNA polymerase, Ribosomes, competing DNA and
47、RNA Model cell volume changes Model excision via Int / Xis / DNA interactions, not Int+Xis complex,Considerations,Phage systems Selection , P22, HK022, P21 to start research + experiment to extend Cross-reactivity Multiple independent attP/attB per integrase E. coli strains Natural phage attB sites Recombination (use RecA-) Copy number F-plasmid? Speed of response Riboregulators? Gateway System intellectual property?,
