1、BSI Standards Publication Molecular biomarker analysis SSR analysis of sunflower PD ISO/TR 17622:2015National foreword This Published Document is the UK implementation of ISO/TR 17622:2015. The UK participation in its preparation was entrusted to Technical Committee AW/275, Food analysis - Horizonta
2、l methods. A list of organizations represented on this committee can be obtained on request to its secretary. This publication does not purport to include all the necessary provisions of a contract. Users are responsible for its correct application. The British Standards Institution 2015. Published
3、by BSI Standards Limited 2015 ISBN 978 0 580 77182 8 ICS 67.050 Compliance with a British Standard cannot confer immunity from legal obligations. This Published Document was published under the authority of the Standards Policy and Strategy Committee on 30 November 2015. Amendments/corrigenda issued
4、 since publication Date Text affected PUBLISHED DOCUMENT PD ISO/TR 17622:2015 ISO 2015 Molecular biomarker analysis SSR analysis of sunflower Analyse molculaire de biomarqueurs Mthode danalyse SSR sur le tournesol TECHNICAL REPORT ISO/TR 17622 Reference number ISO/TR 17622:2015(E) First edition 2015
5、-11-01 PD ISO/TR 17622:2015 ISO/TR 17622:2015(E)ii ISO 2015 All rights reserved COPYRIGHT PROTECTED DOCUMENT ISO 2015, Published in Switzerland All rights reserved. Unless otherwise specified, no part of this publication may be reproduced or utilized otherwise in any form or by any means, electronic
6、 or mechanical, including photocopying, or posting on the internet or an intranet, without prior written permission. Permission can be requested from either ISO at the address below or ISOs member body in the country of the requester. ISO copyright office Ch. de Blandonnet 8 CP 401 CH-1214 Vernier,
7、Geneva, Switzerland Tel. +41 22 749 01 11 Fax +41 22 749 09 47 copyrightiso.org www.iso.org PD ISO/TR 17622:2015 ISO/TR 17622:2015(E)Foreword iv Introduction v 1 Scope . 1 2 Principle 1 3 Consumables and equipment 1 4 Procedure. 1 4.1 Sample preparation 1 4.2 DNA Extraction and Quantification . 2 4.
8、3 PCR amplification . 2 5 Established list of SSR markers for sunflower hybrid conformity testing .3 5.1 Characteristics of the SSRs 3 5.2 SSR primer sequences 4 5.3 Observed SSR profiles of sunflower lines 5 Bibliography 6 ISO 2015 All rights reserved iii Contents Page PD ISO/TR 17622:2015 ISO/TR 1
9、7622:2015(E) Foreword ISO (the International Organization for Standardization) is a worldwide federation of national standards bodies (ISO member bodies). The work of preparing International Standards is normally carried out through ISO technical committees. Each member body interested in a subject
10、for which a technical committee has been established has the right to be represented on that committee. International organizations, governmental and non-governmental, in liaison with ISO, also take part in the work. ISO collaborates closely with the International Electrotechnical Commission (IEC) o
11、n all matters of electrotechnical standardization. The procedures used to develop this document and those intended for its further maintenance are described in the ISO/IEC Directives, Part 1. In particular the different approval criteria needed for the different types of ISO documents should be note
12、d. This document was drafted in accordance with the editorial rules of the ISO/IEC Directives, Part 2 (see www.iso.org/directives). Attention is drawn to the possibility that some of the elements of this document may be the subject of patent rights. ISO shall not be held responsible for identifying
13、any or all such patent rights. Details of any patent rights identified during the development of the document will be in the Introduction and/or on the ISO list of patent declarations received (see www.iso.org/patents). Any trade name used in this document is information given for the convenience of
14、 users and does not constitute an endorsement. For an explanation on the meaning of ISO specific terms and expressions related to conformity assessment, as well as information about ISOs adherence to the WTO principles in the Technical Barriers to Trade (TBT) see the following URL: Foreword - Supple
15、mentary information. The committee responsible for this document is ISO/TC 34, Food products, Subcommittee SC 16, Horizontal methods for molecular biomarker analysis.iv ISO 2015 All rights reserved PD ISO/TR 17622:2015 ISO/TR 17622:2015(E) Introduction Varietal identification testing requires high-q
16、uality markers, which are able to provide reproducible data using a variety of equipment, chemistries, and reagents. Accordingly, this Technical Report only addresses specific amplification methods for sunflower. The aims of this Technical Report are to provide a list of simple sequence repeat (SSR)
17、 markers and methods of analysis for sunflower. The set of SSR markers was established based on expert advice from molecular biologists using lists of publicly-available markers (for ORS markers: Tang et al., 2002: TAG 105:1124-1136 and for SSL markers: GIE Cartisol Paris France), and then validated
18、 through an intralaboratory study at GEVES (Laboratoire BioGEVES, Domaine du Magneraud, CS40052, 17700 SURGERES). The method is applied in officially testing hybrid conformity as part of the process of registering sunflower varieties in the French national varieties catalogue. This document is linke
19、d to ISO 13495 where the different steps towards method validation are listed, and acceptance criteria are defined. ISO 2015 All rights reserved v PD ISO/TR 17622:2015 Molecular biomarker analysis SSR analysis of sunflower 1 Scope The methods and SSR markers included in this Technical Report can be
20、used for testing hybrid conformity and other applications such as molecular fingerprinting of varieties and checking variety identity. 2 Principle SSR analysis is based on the amplification and visualization of the polymorphism caused by variation in the number of repeats in a sequence motif that is
21、 two to five base-pairs in length, also known as a microsatellite. SSR analysis consists of the following steps: sample preparation, DNA extraction, PCR amplification, separation and detection of the PCR products. 3 Consumables and equipment 96-well or 384-well microplate PCR reagents (DNA polymeras
22、e, buffer, MgCl 2 , dNTP, primers, etc.) Capillary electrophoresis reagents Mixer/grinding mill Microplate centrifuge Adjustable-volume micropipettes Micro-centrifuge for microtubes Capillary electrophoresis system with fluorescence detection Thermocycler 4 Procedure 4.1 Sample preparation For each
23、sample, either individual seeds or seed mixes depending on the context are ground using a suitable mill (such as an IKA A10 or a Retsch MM301 1) ). 1) IKA A10 and Retsch MM301 are examples of suitable products available commercially. This information is given for the convenience of users of this doc
24、ument and does not constitute an endorsement by ISO of the product named. Equivalent products may be used if they can be shown to lead to the same results. TECHNICAL REPORT ISO/TR 17622:2015(E) ISO 2015 All rights reserved 1 PD ISO/TR 17622:2015 ISO/TR 17622:2015(E)4.2 DNA Extraction and Quantificat
25、ion a) Obtain an aliquot of each homogenously ground sample; the amount required will depend upon the extraction protocol employed. b) Extract DNA using in house protocol or equivalent NOTE Collaborative study has been carried out with QIAGEN DNeasy 96 Plant Kit 2) . c) The laboratory will validate
26、that the quantity of DNA extracted is appropriated to ensure a reliable result. 4.3 PCR amplification Conditions optimized for ABI 9700 thermocycler. a) Mix preparation (see Table 1). Table 1 Mix preparation Concentration Volume for 1X H 2 O 3,125 l Buffer 10X 1X 1 l dNTP (10 mmol/l) 125 mol/l 0,125
27、 l MgCl 2(25 mmol/l) 3 mmol/l 1,2 l Taq DNA polymerase (5 U/l) 0,25 U 0,05 l Forward primer (10 mol/l) 0,25 mol/l 0,25 l Reverse primer (10 mol/l) 0,25 mol/l 0,25 l Vol 1x mix 6 l DNA (2,5 ng/l) 4 l Final PCR vol 10 l b) Amplification conditions (see Table 2). A touchdown (TD) program is used: the h
28、ybridization temperature is lowered from 64 C to 55 C in decrements of 1 C per cycle. Table 2 Amplification conditions 10 cycles 30 cycles 94 C 94 C TD 94 C 10:00 0:30 * 72 C 0:30 72 C 72 C 64 C 0: 30 55 C 0:30 10:00 10 C 0:30 0:30 NOTE Units for times in Table 2 are in “minutes: seconds”. 2) QIAGEN
29、 DNeasy 96 Plant Kit is an example of suitable product available commercially. This information is given for the convenience of users of this document and does not constitute an endorsement by ISO of the product named. Equivalent products may be used if they can be shown to lead to the same results.
30、2 ISO 2015 All rights reserved PD ISO/TR 17622:2015 ISO/TR 17622:2015(E) 5 Established list of SSR markers for sunflower hybrid conformity testing 5.1 Characteristics of the SSRs Data obtained with a 3130 Genetic Analyser 3)(Applied Biosystems). See Table 3. Table 3 Characteristics of the SSRs No. S
31、SR Linkage group Number of alleles recorded Range of estimated allele sizes (bp) Neis diversity index a 1 ORS309 4 2 121 131 0,48 2 SSL003 14 6 118 142 0,70 3 ORS342 2 5 307 345 0,42 4 ORS547 5 7 178 191 0,68 5 ORS613 10 8 201 230 0,62 6 SSL171 6 129 162 0,62 7 ORS432 3 3 160 164 0,52 8 ORS510 9 3 2
32、48 259 0,37 9 ORS605 1 8 174 203 0,66 10 ORS329 8 2 231 236 0,41 11 ORS621 11 7 232 250 0,63 12 SSL283 4 130 141 0,76 13 ORS307 14 4 109 137 0,53 14 ORS811 17 3 106 155 0,62 15 ORS502 12 5 92 165 0,38 16 ORS407 16 4 426 447 0,43 aValues for the Neis diversity index were obtained on 124 male and fema
33、le lines. NOTE Source is Zhang et al., 2005 2. 3) 3130 Genetic Analyzer is an example of suitable product available commercially. This information is given for the convenience of users of this document and does not constitute an endorsement by ISO of the product named. Equivalent products may be use
34、d if they can be shown to lead to the same results. ISO 2015 All rights reserved 3 PD ISO/TR 17622:2015 ISO/TR 17622:2015(E) 5.2 SSR primer sequences See Table 4. Table 4 SSR primer sequences No. SSR Forward primer sequence (53) Reverse primer sequence (53) 1 ORS309 CATTTGGATGGAGCCACTTT GATGAAGATGGG
35、GAATTTGTG 2 SSL003 CACAACCTTTTCTTCTGCTTCC GAGTCTCATTTGAGCCCACC 3 ORS342 TGTTCATCAGGTTTGTCTCCA CACCAGCATAGCCATTCAAA 4 ORS547 TTGTCTTCATCTGCGTGTGA TTGCTGTTGTTGATCGGTGT 5 ORS613 GTAAACCCTAGGTCAATTTGCAG ATCTCCGGAAAACATTCTCG 6 SSL171 TCTGAACTGGAGGATGGGAC TGCAAAGAAGAAGAAGTGGAGA 7 ORS432 TGGACCAGTCGTAATCTT
36、TGC AAACGCATGCAAATGAGGAT 8 ORS510 CATCGCGTCCCTCTCTCTAA CCAACCATCACAGCAATCAG 9 ORS605 CGCGTGATGTGACGATTATT ACGGAGCAAAGTTTCGAGGT 10 ORS329 CATCCTCCTCACCAACCAGA GGGAAATCTTCTAAACGGTATGG 11 ORS621 CGCCTTATGCTGAGAGGAAA CCTGAAGCGAAGAAGAATCG 12 SSL283 TTCCCAGTTGATTCCCTTTG GAGCATTGGAGGCCAATAAG 13 ORS307 CAGT
37、TCCCTGAAACCAATTCA GCAGTAGAAGATGACGGGATG 14 ORS811 CCTTCTCCTCAATCTTTGGCTA AGGAATGAAATGGGTGTGTGT 15 ORS502 ATCCCAACAGACGCCATTAT AACATTGGAGGGAGCCAATA 16 ORS407 TGGCTAGGATTGCTTCATCA TTTGCTTGCGCTTCTTACCT4 ISO 2015 All rights reserved PD ISO/TR 17622:2015 ISO/TR 17622:2015(E) 5.3 Observed SSR profiles of
38、sunflower lines See Table 5. Table 5 SSR profiles observed for ten sunflower lines during intralaboratory validation Name of the line No. SSR RHA274 RHA377 RHA801 PAC2 RHA266 HA89 H52 HA372 HA383 HA821 1 ORS309 131 131 131 131 131 121 121 131 121 131 2 SSL003 121/139 121 121 121 139 139 139 134 134
39、134 3 ORS342 337 337 337 328 337 340 337 307 337 337 4 ORS547 184 178 184 178 178 178 188 188 178 178 5 ORS613 201/226 201 201 230 226 211 226 226 226 226 6 SSL171 158 129/158 158 129 129 158 129 149 158 129 7 ORS432 164 164 164 162 164 164 162 162 164 160 8 ORS510 248/257 257 253 248 257 257 257 25
40、7 248 257 9 ORS605 197 199 197 197 197 197 199 203 189 189 10 ORS329 231 236 236 231 236 236 236 236 236 236 11 ORS621 240 239 239 235 233 250 235 235 250 235 12 SSL283 130 130 130 133 130 130 130 130 130 139 13 ORS307 135 112/135 112 112 112 135 112 112 112 112 14 ORS811 110 155 110 155 110 155 106
41、 106 155 106 15 ORS502 116 116 116 116 116 92 116 116 116 116 16 ORS407 426 443 426 426 441 443 null allele 441 443 441 Molecular profiles of ten sunflower lines are reported as estimated fragment sizes in bp for each of 16 SSR markers. For a given SSR in a line, a single fragment size indicates the
42、 marker is monomorphic within the line while two fragment sizes indicate that the marker is polymorphic within the line. The “null allele” entry indicates the absence of a PCR product in the repeatability and reproducibility tests. ISO 2015 All rights reserved 5 PD ISO/TR 17622:2015 ISO/TR 17622:201
43、5(E) Bibliography 1 Tang S., Yu J.K., Slabaugh M.B., Sintani D.K., Knapp S.J. Simple Sequence Repeat Map of the sunflower genome. TAG. 2002, 105 pp. 11241136 2 Zhang L.S., Le Clerc V., Li S., Zhang D. Establishment of an effective set of simple sequence repeat markers for sunflower variety identific
44、ation and diversity assessment. Can. J. Bot. 2005, 83 pp. 66726 ISO 2015 All rights reserved PD ISO/TR 17622:2015This page deliberately left blankThis page deliberately left blankBSI is the national body responsible for preparing British Standards and other standards-related publications, informatio
45、n and services. BSI is incorporated by Royal Charter. British Standards and other standardization products are published by BSI Standards Limited. British Standards Institution (BSI) BSI Group Headquarters 389 Chiswick High Road London W4 4AL UK About us We bring together business, industry, governm
46、ent, consumers, innovators and others to shape their combined experience and expertise into standards -based solutions. The knowledge embodied in our standards has been carefully assembled in a dependable format and refined through our open consultation process. Organizations of all sizes and across
47、 all sectors choose standards to help them achieve their goals. Information on standards We can provide you with the knowledge that your organization needs to succeed. Find out more about British Standards by visiting our website at or contacting our Customer Services team or Knowledge Centre. Buyi
48、ng standards You can buy and download PDF versions of BSI publications, including British and adopted European and international standards, through our website at where hard copies can also be purchased. If you need international and foreign standards from other Standards Development Organizations,
49、 hard copies can be ordered from our Customer Services team. Subscriptions Our range of subscription services are designed to make using standards easier for you. For further information on our subscription products go to With British Standards Online (BSOL) youll have instant access to over 55,000 British and adopted European and international stan
